|
University of Washington Libraries Catalog Menu
Search the UW Libraries
An Investigation of Therac-25 Accidents - I
An Investigation of Therac-25 Accidents - I An Investigation of the Therac-25 Accidents Nancy Leveson, University of Washington Clark S. Turner, University of California, Irvine Reprinted with
Deep Throat: Uncovered | Department of Journalism | University of
Today he is a respected Washington lawyer with an illustrious past that
ECONOMICS Working Paper Archive
This award winning service (provided by the Economics Department of Washington University ), is devoted to the free distribution of working papers in economics. There are 22 subject areas , along
University of Washington - Official Athletic Site
Tickets | Schedules | Online Store | TV/Radio | Audio/Video MEN'S SPORTS • Baseball • Basketball • Crew
Baseball - University of Washington- Official Athletic Site
Tickets | Schedules | Online Store | TV/Radio | Audio/Video MEN'S SPORTS • Baseball • Basketball • Crew
Debtor Creditor Rights Attorney Heritage Law Offices Seattle
2001 Education: Seattle University School of Law Seattle Washington 1999 County
The Transactional Interpretation of Quantum Mechanics
The Transactional Interpretation of Quantum Mechanics John G. Cramer Department of Physics University of Washington PO Box 351560 Seattle WA 98195-1560 USA This paper was originally published in
PROBABILITY THEORY -- THE LOGIC OF SCIENCE
PROBABILITY THEORY: THE LOGIC OF SCIENCE by E. T. Jaynes Wayman Crow Professor of Physics Washington University St. Louis, MO 63130, U.S.A. Dedicated to the Memory of Sir Harold Jeffreys, who saw
rccs transfer
On September 1, 2001, the Resource Center for Cyberculture Studies moved. It is now being hosted by the School of Communications at the University of Washington. Please visit us at:
How to Make a Gift: UW Gift Planning
and financial planning to benefit both you and the University of Washington Planned gifts include outright gifts life income gifts retained life estate gifts
UWT University of Washington Tacoma Homepage: registration
4669. Telephone registration ends The University of Washington has
The W.U.S.M. Neuroscience Tutorial
The Washington University School of Medicine Neuroscience Tutorial An illustrated guide to the essential basics of clinical neuroscience created in conjunction with the first-year course for medical
Turning Point - Collaborating for a New Century in Public Health
Funded by: The Robert Wood Johnson Foundation. Located at: University of Washington
2002 Big West Shootout-Day 2 :: Gauchos faced Hawaii Pacific
of Pacific University of Nevada Las Vegas 8 vs Univ. Washington Univ.
UMCA Career Fair Registration
This year the University of Washington Business Career Fair is the day
W. H. Calvin's THE ASCENT OF MIND (Chapter 8)
Home Page || Public Bookmarks || Science Surf column || The Calvin Bookshelf A book by William H. Calvin UNIVERSITY OF WASHINGTON SEATTLE, WASHINGTON 98195-1800 USA T he A
Official Athletic Site of the Washington State University Cougars
Cougar Online Auction - Cougar Memorabilia Butch Auction Signup Cougar Club Cougar
Washington University in St.Louis - School of Medicine
Washington University in St.Louis - School of
ALPHASIGMAPHI.COM | MU CHAPTER | EST 1912 | UNIVERSITY OF
[ Home ] [ ALUMNI ] [ BROTHERS ] [ MUSINGS ] [ PHILANTHROPY ] [ PHOTOS ] [ RUSH
ATS Website
University of Washington Pharmaceutics Metabolic Drug Interaction
Virtual Tours - University of Washington 360 Degree Virtual Tour
Red Square is the central gathering spot at the University of Washington
University of Washington housing at Commodore Duchess Apartments
www.CommodoreDuchess.com Welcome to Commodore Duchess! You MUST be a student
In the Media: Ventura County Star Newspaper
The 604-pound car from Western Washington University was the first of seven solar-powered cars that drove through Ventura County on Saturday in a six-day race
Erik S. Jaffe of Washington DC - Attorney Profile
Attorney Profile. EDUCATION. Columbia University School of Law New
Organizers and Scientific Committee
Biomaterials (UWEB) Washington Research Foundation Endowed Professor of Bioengineering
GeneTests Home Page
principles of. the Health On the. Net Foundation. Contact GeneTests. Copyright©
University of Washington - Official Athletic Site
Tickets | Schedules | Online Store | TV/Radio | Audio/Video MEN'S SPORTS • Baseball • Basketball • Crew
George Washington University - Official Athletic Site
George Washington University - Official Athletic
Washington dc hotels George Washington University Inn.
George Washington University Inn located in the heart of downtown area is the esitemarketing.com. dc hotel in heart of downtown area. dc hotel in great
The Electronic Hallway
of Public Affairs at the University of Washington. © 2003 The Electronic
Hammond Ashley Music Links
Seattle Symphony; Seattle Youth Symphony Orchestra; University of Washington School
UW Hillel
High Holidays. Services will be led by Rabbi Dan Bridge Rabbi Will Berkovitz
Human Services Policy Center
Human Services Policy Center University of Washington Box 354804 1107 NE 45th
Husky Marching Band
Join the Husky Band! Are you interested in becoming a part of the University
The IMAP Connection -- IMAP Products and Services
University of Washington regarding the features functionality suitability or
KUGS 89.3 FM - Home
The mission of KUGS-FM is to serve the students of Western Washington University
History
University of Washington in Seattle the Lifetime Fitness Program has evolved
Mechanical & Aerospace Engineering
MAE Mission Statement and Educational Objectives The Mechanical and Aerospace Engineering Department at The George Washington University's School of Engineering and Applied Science
Mechanical Engineering, Undergraduate Advising Information
Quick Tips and Web Links for a Job Search General Information at the University of Washington Summer Internships/Engineering Co-op Strategies for a Job Hunt Web resources Networking and career fairs
Medical Training Solutions
MTS was created by the University of Washington with the mission to develop on-line
Mohs Profile Search
of dermatologic surgery training at Washington University in St. Dermatologic Surgery
MS Center at Washington University School of Medicine
Department of Neurology Mission To combat multiple sclerosis through Patient Care, Research, and Education to fulfill the following objectives: To diagnose and/or confirm the diagnosis of MS. To
University of Washington Educational Outreach - Page Not Found
University of Washington Educational Outreach - Page Not Found LINK REL="stylesheet
Staff
School of Law Administrative Staff Donald J. Polden Dean and Professor of Law B. A., 1970, The George Washington University; J. D., 1975, Indiana University. Admitted : Iowa. Email:
photograds.com - University of Washington - Seattle
Welcome to photograds.com the Official Commencement Photographer for
Green Group
Laboratory of PHIL GREEN. CCAGTAATGCACGAGACACAAA
Places. University Place Washington community information
Your Online Home Base For UNIVERSITY PLACE WASHINGTON Please enjoy exploring
Curriculum Vitae -- James M. Nachbar MD FACS Plastic Surgery
Graduate: Washington University School of Medicine St. Louis Missouri MD May
University of Washington Schools of Medicine and Nursing Awarded
The University of Washington Schools of Medicine and Nursing today received
Re: JERSEY-DRESSES
Huskies Talk University of Washington sport teams football basketball
Sights and Sounds of Pullman
Sights and Sounds of Pullman. Where to Stay Things to See Washington State University
Remote Medicine: Board of Directors
He is a graduate of the University of Washington School of Medicine in Seattle and
UW Bio
University of Washington BioEngineering. and Genomic Sciences Buildings. Seattle
St. Luke's Rehabilitation Institute :: Patient Success Stories
Winning the Game The Story Of: Mike Utley & David Sims Washington State University
University of Washington, Tacoma
This site's design is only visible in a graphical browser that supports web standards , but its content is accessible to any browser or Internet device. [ ] [ ] [ ] [ ] [ ] [ ] [ ] | | [ ] [ ] [ ] [
List of Registrants
INSERM U563 Washington University Fox Chase Cancer Center The Scripps Research
Unmanned Dynamics -- Gallery: University of Washington
Aerosonde Robotic Aircraft. Dara Aviation Flight Demo. University of
Welcome to University Book Store 2003
Store. Privacy & Security | Contact Us | 1-800-335-7323 | 4326 University
The University of Washington
Walking distance to University of Washington less than three miles to downtown. Here
Center for Women's Health Research
The CWHR is part of the University of Washington School of Nursing and is funded
University of Washington Division of Gastroenterology - Heal
Another common symptom is pain; it may be caused by a blockage of the main pancreatic
University of Washington Lambda Phi Epsilon
Lambda Phi Epsilon is an Asian American interest fraternity at the University
UW Medicine - Health Plans / Insurance
care from a University of Washington physician under the following plans: Aetna
University of Washington Eye Center
Cosmetic Surgery Center See map 4245 Roosevelt Wy NE Box 354716 Seattle Washington
Choose UWTV Production for Television and Video Production
UWTV Production based at the University of Washington in Seattle provides professional
University of Washington - VRSeattle.com Quicktime VR Virtual
University of Washington. The University of Washington serving over
Welcome to Washington Baseball Camps
CAMPS Washington Baseball Camps are staffed by the University of Washington coaching
Washington Semester Program - Home - American University
American University's Washington Semester program in Washington DC combines internships
Washington Square News
washingtonsquarenews.com is the website of New York University's daily student
Washington State Nurses Foundation - Grants
1997 Nursing Scholarships Doris Boutain University of Washington Rebecca S Health
Washington University School of Law
Washington University School of
Western Washington University Vikings Official Athletic Site
4 One of the fiercest small college rivalries in the country and the second-biggest
| 